CPSC536a - Assignment 1 (covers Module 1)

handed out Tue, 01/01/16; due Tue, 01/01/23

1 DNA, RNA, Proteins [5 marks]

Consider the following (incomplete) prokaryotic mRNA sequence

guccaggagcag...gacucagacuga

a) What is the corresponding complementary DNA sequence? [1 mark]

b) What is the amino-acid sequence of the corresponding gene product (protein)? [2 marks]

c) If the mRNA sequence were eukaryotic instead of prokaryotic, what could you say about the corresponding gene from which it was transcribed? [2 marks]

2 Genetic Code [7 marks]

As a reading assignment, you have read Douglas Hofstadter's article 'The Genetic Code - Arbitrary'.

a) Briefly outline the thought experiment which is provided to support the hypothesis that the genetic code is arbitrary. (No more than 200 words.) [2 marks]

b) Briefly outline the major objections to the hypothesis that the genetic code is arbitrary, as discussed in the article itself, including the postscriptum. (No more than 200 words.) [2 marks]

c) Based on what you've learned so far, can you elaborate the objections from part b, lending them even more credibility? Can you think of additional objections to Hofstadter's hypothesis that are not mentioned in the article? (No more than 200 words.) [3 marks]

3 Methods and Techniques [9 marks]

Consider the following fragment of single-stranded DNA:

ATGTGAGAATTGATGGAGATATATTTAGTGGAACATGCAATAGTGAGAATTGATGGAGAA ATAAAAAGAAAGAATAAGAAGGATAAGAGAAGAGGTAAAAAAGAGGGAAGGAGATAATTA

a) Design primers of length 18 for amplifying the subfragment starting at position 4 and ending after position 117 (positions are counted 1,2,..,120.) [1 mark]

b) Which other PCR product(s) do you get when using the primers from part a) and how could you potentially separate these from the target molecules? [3 marks]

c) How many cycles of PCR are required to get approx. 2*10^9 target molecules, assuming the process works absolutely error-free and at maximum efficiency. (Show all relevant steps of the calculation. Hint: A target molecule is an exact copy of the subfragment specified in part a) [2 marks]

d) If the PCR process had an error rate of 2*10^-4 per base, i.e., with a probability of 2*10^-4 another base than the one complementary to the template is added to the strand being replicated, how many cycles of PCR could you perform before the expected number of target molecules containing at least one error exceeds 1? (Hint: Consider the probability of synthesising one DNA strand error-free during a PCR cycle. The probability distribution for synthesising n strands without an error is a geometric distribution.) [2 marks]

General remarks:

While cooperation between students - especially between CS and non-CS students - is encouraged, each student is expected to work out the actual solutions to the problems individually and hand in their own assignment. In other words: help each other, but do not copy solutions.
Feel always free to contact Anne or Holger if you feel you need further help than can be provided by your fellow students.
The assignment has to be handed in on the date it is due before or at the beginning of class.
This assignment should take you about 1.5-3 hours of work, if you have good knowledge of the topics covered and did all reading assignments. However, don't wait until the last minute relying on this estimate - it might not apply to you (or anyone at all), you might need additional time to consult the literature, ...