CPSC445/545 - Assignment 4 (covers Module 5)

released: Tue, 04/11/09; due: Tue, 04/11/16 at 16:00

NOTE: CPSC 545 students are only required to solve problems 1 and 4; CPSC 445 students are expected to solve all problems.


1  RNA secondary structure [7 marks]

(a) Given the following RNA secondary structure, name all of the secondary structure elements and specify their positions in terms of the respective exterior and interior base-pairs.
[2 marks]

(b) Make structure from part (a) pseudoknot free by removing a minimal number of base pairings. (You don't have to redraw the structure, just list the positions of the base pairings that need to be removed.) [1 marks]

(c) Calculate free energy of the following RNA secondary structure based on the Turner Group energy parameters that can be found at https://www.bioinfo.rpi.edu/~zukerm/rna/energy/, use tables for 37 degree Celsius for RNA folding. [4 marks]


2  RNA secondary structure exploration with software tools (Hands-on Problem) [445 students only, 5 marks]

(a) Given the following sequence of the pseudoknotted XS1 ribozyme, use the MFOLD program of Zucker et al. to predict secondary structure (using default parameters), and compare the optimal structure to the original biological structure given in Figure 3. What do you notice? [2 marks]

XS1 ribozyme sequence and structure:
GCGAGAAACCCAAAUUUUGGUAGGGGAACCUUCUUAACGGAAUUC
AACGGAGAGAAGGACAGAAUGCUUUCUGUAGAUAGAUGAUUGCCG
CCUGAGUACGAGGUGAUGAGCCGUUUGCAGUACGAUGGAACAAAA
CAUGGCUUACAGAACGUUAGACCACUUACAUUUGGGAUCCUAACG
UUCGGGUAAUCGCUGCAGAUCUUGAAUCUGUAGAGGAAAGUCCAU
GCUCGCACGGUGCUGAGAUGCCCGUAGUGUCCAGACUGAAGAUCU
GGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCAGCGGAUUUA

(b) Using the RNA Designer program of Andronescu et. al, design an RNA sequence that folds into the following structure given in dot-parenthesis notation (where dots indicate unpaired bases and parenthesis paired bases):

((((((.((.(((((((((........(((....))).......)))))..))))..)))))))).

Report the sequence and free energy obtained. [1 mark]

(c) Fold the following biological sequence using MFOLD (using default parameters):

AAACAGAGAAGUCAACCAGAGAAACAGACGUUGUCGUAUAAUACCUGGUACUGACAGUCCUGUUUU

What do you notice when you compare the free energy of the resulting structure and the minimal free energy from ten sequences for the same structure obtained from RNA Designer (with default parameters)? [2 mark]


3  Protein structure in the 2D HP model [445 students only, 3 marks]

(a) Consider the following structure of the hydrophobic-polar sequence HHPHPHPHPPHPPHH in the 2D HP model:

Calculate the free energy of this structure under the HP model. [1 mark]

(b) Find an alternate structure for the sequence from part (a) with lower free energy <= -7. (Hint: The last hydrophobic residue has to be in contact with three other H residues) [2 marks]


4  Knowledge testing questions [7 marks]

[Give all answers in your own words, cite references where appropriate <= 100 words]

(a) List three fundamental approaches to tertiary protein structure prediction and briefly explain under which circumstances each of them is appropriate. [3 marks]

(b) Briefly explain the role of the hydrophobic force in protein folding. [2 marks]

(c) Briefly explain Levinthal's paradox. [2 marks]


General remarks: