Tags:
tag this topic
create new tag
view all tags
Assume for all instances below that a single FASTA reference =ref.fasta= and a single FASTQ read file =reads.fastq= are in the same directory as the program executable Running [[http://bowtie-bio.sourceforge.net/tutorial.shtml][bowtie]]: * Build the index * =bowtie-build ref.fasta reference= * Single-end alignments * =bowtie -S reference reads.fastq output.sam= (=-S= required for SAM output) Running [[http://bio-bwa.sourceforge.net/bwa.shtml][bwa]] * Build the index * =bwa index ref.fasta= * Single-end alignment * =bwa aln ref.fasta reads.fastq > output.sai= * Convert to SAM * =bwa samse ref.fasta output.sai reads.fastq > output.sam= Running [[http://bioinformatics.bc.edu/marthlab/Mosaik][Mosaik]] * Build the index * =MosaikBuild -fr ref.fasta -oa ref.dat= * Convert the reads * =MosaikBuild -q reads.fastq -out reads.dat -st illumina= (=illumina= is the machine the reads were produced by) * Single-end alignments * =MosaikAligner -in reads.dat -out output.dat -ia ref.dat -hs 14 -act 17 -mm 2 unique= * Convert to SAM * =MosaikText -in output.dat -sam output.sam= Note that the above was adapted from the =Build= and =Align= scripts from in the =data= directory of the Mosaik download. Running [[http://www.cs.helsinki.fi/group/suds/readaligner/][readaligner]] * Build the index * =builder ref.fasta= * Single-end alignments * =readaligner -k 2 -v -s -o output.sam ref.fasta -q reads.fastq= * =-k 2= for up to 2 mismatches * you can change =-k= to =-i= for 2 gaps (in my experience, runs much slower) * =-v= for verbose * =-s= for sam output (I don't think that readaligner output is tview friendly yet...) * =-o= to specify the output file * =-q= to specify that input is FASTQ If all went well, you should obtain an =output.sam= file, using any of the above programs... You can then display this using [[http://samtools.sourceforge.net/][SAMTools]]: * Index the reference * =samtools faidx ref.fasta= * Convert SAM to BAM * =samtools import ref.fasta output.sam output.bam= * Sort the BAM (orders the reads by positions in the reference) * =samtools sort output.bam sorted= (will create =sorted.bam=) * Index the sorted BAM (unsorted BAM files cannot be indexed) * =samtools index sorted.bam= * Display * =samtools tview sorted.bam ref.fasta= On a side note, you can convert a BAM file to a SAM file like so: * =samtools view sorted.bam > sorted.sam= As typing these can be a real pain, I actually automate the process using batch files... Some notes about output... The below three are considered "identical" for our purposes <verbatim> baligner SLXA-EAS1_89:1:1:672:654/1 0 gi|170079663|ref|NC_010473.1| 4017473 65 35M * 0 0 GCTACGGAATAAAACCAGGAACAACAGACCCAGCA cccccccccccccccccccc]c``cVcZccbSYbY NM:i:0 MD:Z:35 AS:i:35 bwa SLXA-EAS1_89:1:1:672:654 0 gi|170079663|ref|NC_010473.1| 4017473 37 35M * 0 0 GCTACGGAATAAAACCAGGAACAACAGACCCAGCA cccccccccccccccccccc]c``cVcZccbSYbY XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:35 bowtie SLXA-EAS1_89:1:1:672:654/1 0 gi|170079663|ref|NC_010473.1| 4017473 255 35M * 0 0 GCTACGGAATAAAACCAGGAACAACAGACCCAGCA cccccccccccccccccccc]c``cVcZccbSYbY XA:i:0 MD:Z:35 NM:i:0 </verbatim> Some notes about the columns: 1. name: may vary slightly only 2. flag: should be identical 3. reference: should be identical 4. position: identical for unique reads only (not for multimap, to see if this is true, check the =XT= tag at the end bwa output * =XT:A:U= means the read is a single =Unique= read, which =XT:A:R= means it's a =Randomly= selected multimap read 5. mapping quality: different (our numbers should be nearly identical to MOSAIK, another aligner) 6. cigar: identical for unique reads only (an encoding of the aligned read) 7. mate reference: * for single end 8. mate position: 0 for single end 9. insert size: 0 for single end 10. sequence: should be identical 11. quality: should be identical 12. everything beyond is a tag, which vary greatly between programs but when present... * =NM= is the number of mismatches, and should be identical * =MD= is an encoding of the aligned reference, and should be identical A more interesting example: <verbatim> baligner SLXA-EAS1_89:1:1:713:81/1 0 gi|170079663|ref|NC_010473.1| 4058875 5 17M1D18M * 0 0 AAAAGCTGGGTGAGTGGCGATGACGCGCAATAAAA cccccccccccccccccccccccccccJcc^^bb^ NM:i:1 MD:Z:17^G18 AS:i:32 bwa SLXA-EAS1_89:1:1:713:81 0 gi|170079663|ref|NC_010473.1| 4058875 37 15M1D20M * 0 0 AAAAGCTGGGTGAGTGGCGATGACGCGCAATAAAA cccccccccccccccccccccccccccJcc^^bb^ XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:0 XO:i:1 XG:i:1 MD:Z:15^G20 bowtie SLXA-EAS1_89:1:1:713:81/1 4 * 0 0 * * 0 0 AAAAGCTGGGTGAGTGGCGATGACGCGCAATAAAA cccccccccccccccccccccccccccJcc^^bb^ XM:i:0 </verbatim> In this case, bowtie returns an unmapped hit (it doesn't allow indels by default), while bwa returns an identical unique hit. Note that the CIGAR and MD are slightly different, but upon further investigation, the different is due to where the gap is introduced: we place the gap on the last G in the triplet of G's, while bwa places the gap on the first. And finally, a multimap example, when =allow_multimap= is =true=: <verbatim> baligner SLXA-EAS1_89:1:1:721:668/1.1 0 gi|170079663|ref|NC_010473.1| 521562 62 35M * 0 0 GCTGTAGATCTGGAAATCGCAACGGAGGAAGAAAG ccccccccccccccccccccccccccccccbbbbb NM:i:0 MD:Z:35 AS:i:35 SLXA-EAS1_89:1:1:721:668/1.2 0 gi|170079663|ref|NC_010473.1| 634822 62 35M * 0 0 GCTGTAGATCTGGAAATCGCAACGGAGGAAGAAAG ccccccccccccccccccccccccccccccbbbbb NM:i:0 MD:Z:35 AS:i:35 bwa SLXA-EAS1_89:1:1:721:668 0 gi|170079663|ref|NC_010473.1| 521562 0 35M * 0 0 GCTGTAGATCTGGAAATCGCAACGGAGGAAGAAAG ccccccccccccccccccccccccccccccbbbbb XT:A:R NM:i:0 X0:i:2 X1:i:2 XM:i:0 XO:i:0 XG:i:0 MD:Z:35 XA:Z:gi|170079663|ref|NC_010473.1|,+634822,35M,0;gi|170079663|ref|NC_010473.1|,+633775,35M,1;gi|170079663|ref|NC_010473.1|,+520515,35M,1; bowtie SLXA-EAS1_89:1:1:721:668/1 0 gi|170079663|ref|NC_010473.1| 521562 255 35M * 0 0 GCTGTAGATCTGGAAATCGCAACGGAGGAAGAAAG ccccccccccccccccccccccccccccccbbbbb XA:i:0 MD:Z:35 NM:i:0 </verbatim> Note that our programs finds two exact match hits, and lists them both with unique names. =bwa= is slightly interesting: * it randomly selects one of the two positions we found * =XT:A:R= means that it's a =Random= multimap * =X0:i:2= means that it found 2 exact matches (0 mismatches) * =X1:i:2= means that it found 2 matches with 1 mismatch * =XA:Z:gi|170079663|ref|NC_010473.1|,+634822,35M,0;gi|170079663|ref|NC_010473.1|,+633775,35M,1;gi|170079663|ref|NC_010473.1|,+520515,35M,1;= lists the three other matches (the 1 other perfect match + the two 1 mismatch hits) =bowtie= just picks one, and doesn't tell you that it's a multimap at all... (consequently, bowtie runs twice as fast as bwa)
E
dit
|
A
ttach
|
Watch
|
P
rint version
|
H
istory
: r4
<
r3
<
r2
<
r1
|
B
acklinks
|
V
iew topic
|
Ra
w
edit
|
M
ore topic actions
Topic revision: r4 - 2010-05-20
-
jujubix
Home
Site map
BETA web
Communications web
Faculty web
Imager web
LCI web
Main web
SPL web
Sandbox web
TWiki web
TestCases web
BETA Web
Create New Topic
Index
Search
Changes
Notifications
RSS Feed
Statistics
Preferences
P
View
Raw View
Print version
Find backlinks
History
More topic actions
Edit
Raw edit
Attach file or image
Edit topic preference settings
Set new parent
More topic actions
Account
Log In
Register User
E
dit
A
ttach
Copyright © 2008-2025 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki?
Send feedback